Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: SEMA4C is associated with decreased survival in colon cancer patients and is linked with increased invasiveness in colon cancer cells. Prognostic power of SEMA4C in colon cancer was analyzed with cancer multiomics database DriverDBv3 in terms of overall (A) and disease-free (B) survival. Peptide expression of SEMA4C in colon cancer and normal tissue (C) was analyzed with the mass spectrometry result from reference 36. Human colon cancer cell line HCT116 (D-H) and mouse colon cancer cell line CT26 (I-M) were treated with control IgG or SEMA4C antibody and analyzed with flow cytometry (D, I), antibody internalization assay (E, J), assays of proliferation (F, K), migration (G, L), and invasion (H, M).

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Expressing, Mass Spectrometry, Flow Cytometry, Migration

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: Ectopically expressed SEMA4C increases colon cancer motility. HCT116 (A, C, E, G) and SW480 (B, D, F, H) were transfected with control vector or SEMA4C-overexpressing plasmid, and analyzed for expression (A, B), proliferation (C, D), migration (E, F), and invasion (G, H).

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Transfection, Plasmid Preparation, Expressing, Migration

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: RNA sequencing reveals the alteration of cell adhesion pathway in SEMA4C-overexpressing colon cancer cells. RNA sequencing results from TCGA colon cancer dataset (A, C) or the present study (B, D) were analyzed for SEMA4C-associated biological pathways (A, B) and gene sets (C, D). For validation, HCT116 (E, G) and CT26 (F) cells were subjected to SEMA4C blockage (E, F) or SEMA4C overexpression (G) and the results were analyzed for cell adhesion (E-G).

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: RNA Sequencing Assay, Over Expression

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: SEMA4C affects tubulin acetylation via CRMP3. HCT116 (A, B, D, F-I) and CT26 (C, E) under the condition of SEMA4C blockage (A, B) or SEMA4C overexpression (C) were analyzed for alterations in total protein acetylation on lysine and tubulin acetylation. In addition, expressions of total tubulin and CRMP3 were also investigated. GAPDH served as internal control. Protein-protein interactions between SEMA4C and CRMP3 in HCT116 (D) and CT26 (E) were determined by immunoprecipitation of CRMP3 and subsequent Western blotting with human- or mouse-specific SEMA4C antibody as described. In functional validation, HCT116 cells were transfected with control vector or CRMP3-overexpressing plasmid and treated with control IgG or SEMA4C antibody (F, G) for cell migration (F) and invasion assays (G). On the other hand, HCT116 cells were transfected with control vector or SEMA4C-overexpressing plasmid, followed by transfection of shRNA against luciferase or against CRMP3 (H, I), with their effects on migration (H) and invasion (I) being analyzed as well.

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Over Expression, Immunoprecipitation, Western Blot, Functional Assay, Transfection, Plasmid Preparation, Migration, shRNA, Luciferase

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: HDAC inhibitor Vorinostat inhibits SEMA4C-increased cell motility. TCGA colon cancer based- and L1000CDS2-predicted SEMA4C-counteracting therapeutics were shown (A) and HDAC inhibitor was selected for in vitro validation on proliferation (B), migration (C), and invasion (D) in HCT116.

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: In Vitro, Migration

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: Dual targeting of SEMA4C by neutralizing antibody and miRNA synergistically suppresses cell invasiveness. miRNAs targeting SEMA4C were identified by overlapping predicted miRNA from databases miRDB, TargetScan, and miRWalk, and the prognostic power of predictive miRNA let-7b (A) and its targeting onto SEMA4C 3’-UTR (B) were shown. Effect of let-7b mimic on proliferation in HCT116 was checked (C). Effects of dual targeting by neutralizing antibody and let-7b mimic on SEMA4C expression (D), migration (E), and invasion (F) in HCT116 were analyzed.

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Expressing, Migration

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: Inhibition of SEMA4C reduces PD-L1 level in colon cancer cells. Correlation of PD-L1 (CD274) and SEMA4C in TCGA COAD dataset was shown (A). Effect of SEMA4C antibody blockage (B) or SEMA4C overexpression (C) on PD-L1 expression in HCT116 was analyzed by Western blotting.

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Inhibition, Over Expression, Expressing, Western Blot